View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5182-Insertion-8 (Length: 224)
Name: NF5182-Insertion-8
Description: NF5182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5182-Insertion-8 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 7 - 224
Target Start/End: Original strand, 1794692 - 1794909
Alignment:
| Q |
7 |
aaagggaacatacaattctgagaacatatatgctcaagctctcataaaacaagtctccatggcatgaacccatcacatggaaatggaatcaccaaaacaa |
106 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1794692 |
aaagggaacatacaattctcagaagatatatgctcaagctctcataaaacaagtctccatggcatgaacccattacatggaaatggaatcaccaaaacaa |
1794791 |
T |
 |
| Q |
107 |
taaatagtatcgtagccgcatccttcttttctcttttcctcttcaccttcttcaaccacttgataaggggtggtttaagaccattctttccccgctaaat |
206 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1794792 |
taaatagtatcgtagccgcacccttcttttctcttttcctcttcaccttcttcaaccacttgataaggggtggtttaagaccattctttccccgctaaat |
1794891 |
T |
 |
| Q |
207 |
tattcatctaattagttt |
224 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
1794892 |
tatccatctaattagttt |
1794909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University