View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5182_low_4 (Length: 208)

Name: NF5182_low_4
Description: NF5182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5182_low_4
NF5182_low_4
[»] chr7 (1 HSPs)
chr7 (1-189)||(32797572-32797760)


Alignment Details
Target: chr7 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 32797572 - 32797760
Alignment:
1 ggaagactctcaacaacaaccaccgcaacaaattgcgccgatgacaatcgacggcgccgacgaagacttagcactcgcggcctcctccgtcttaacccgc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
32797572 ggaagactctcaacaacaaccaccgcaacaaattgcgccgatgacaatcgacggcgccgacgaagacttagcactcgcggcctcttccgtcttaacccgc 32797671  T
101 cgcgaggtcctcgttcgccgcctccgccgtgtcagacagctctctcgctgttaccgaggtcattactgggcgttaatggaagagcttaa 189  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
32797672 cgcgaggtcctcgttcgccgcctccgccgtgtcagacaactctctcgctgttaccgaggtcattactgggcgttaatggaagagcttaa 32797760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University