View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5183-Insertion-7 (Length: 321)
Name: NF5183-Insertion-7
Description: NF5183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5183-Insertion-7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 8 - 321
Target Start/End: Complemental strand, 29517113 - 29516804
Alignment:
| Q |
8 |
cttttgcgtcaaatggactcttaggaagaaaactttgggattttagcaacaagttgatcaattcaatttcaaagtcttgatttgtcttgctcatccatca |
107 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29517113 |
cttttgcgtcaaatggactattaggaagaaaactttgggattttagcaacaagttgatcaattcaatttcaaagtcttgatttgtcttgctcatccatca |
29517014 |
T |
|
| Q |
108 |
ctctcgtcaaatcaattattagtagttatatatatgacttgtattatgtgcccctaaaatagaagccttcttcttttgtgtgtacttactttattgaata |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29517013 |
ctctcgtcaaatcaattattagtagttatatatatgacttgtattatgtgcccctaaaatagaagccttcttcttttgtgtgt----actttattgaata |
29516918 |
T |
|
| Q |
208 |
ttatctttcaaggttaacggtattaattaagtgttggtgatagctcaaactttaattatgtttctccttctctattgtttgaaccggatcctttaatttc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29516917 |
ttatctttcaaggttaacggtattaattaagtgttggtgatagctcaaactttaattatgtttctccttctctattgtttgaaccggatcctttaatttc |
29516818 |
T |
|
| Q |
308 |
ttaaacttgttcga |
321 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
29516817 |
ttaaacttgttcga |
29516804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 40103795 - 40103860
Alignment:
| Q |
24 |
actcttaggaagaaaactttgggattttagcaacaagttgatcaattcaatttcaaagtcttgatt |
89 |
Q |
| |
|
|||||||| || |||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40103795 |
actcttagcaaagaaactttgggatttcagcaacaagttgatcaattcaatttcaaaagcttgatt |
40103860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University