View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5183_high_31 (Length: 228)
Name: NF5183_high_31
Description: NF5183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5183_high_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 25 - 221
Target Start/End: Original strand, 16701789 - 16701985
Alignment:
| Q |
25 |
gataaaaagctaattcttttgagacaagattcattacccttttgctctataattgattcaattttagtaataccctttataagctcaaggttgcttgagc |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| ||||||||||||||||||||||||||||| |
|
|
| T |
16701789 |
gataaaaagctaattcttttgagacaagattcattacccttttgctctataattgattcaattgtactaaaaccctttataagctcaaggttgcttgagc |
16701888 |
T |
 |
| Q |
125 |
tggattcactcnnnnnnngagaggcctctttaatttataaattctaatgcactttggtggatgtgacacgttgggaaaatagttatgtcctttgctt |
221 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16701889 |
tggattcactcaaaaaaagagaggcctctttaatttataaattctaatgcactttggtggatgtgacacgttgggaaaatagttatgtcctttgctt |
16701985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University