View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5183_high_7 (Length: 468)
Name: NF5183_high_7
Description: NF5183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5183_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 16 - 400
Target Start/End: Complemental strand, 43212404 - 43212030
Alignment:
| Q |
16 |
cactagctacccaaacctcacgagaatcataaatcctcactttttctctccacaaactataatatcgatcactcccaacaaaactaactatcaaaataat |
115 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |||| |
|
|
| T |
43212404 |
cactagctacccaaacttcacgagaatcataaatcctcactttttctctccacaaactataatatc----actcccaacaaa-----ctatcaaa-taat |
43212315 |
T |
|
| Q |
116 |
agcaacaaaaacatatttcacacaacacaaaatgctaccatacactactatctttcttatctttctcatcacttccatggccgcagccagcagtggcgga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43212314 |
agcaacaaaaacatatttcacacaacacaaaatgctaccatacactactatctttcttttctttctcatcacttccatggccgcagccagcagtggcgga |
43212215 |
T |
|
| Q |
216 |
agaaagctagatatggcaagcggtggttctccgacaggtgcaagtggttctggccacggtccaaattgggactatagctggggatgggggtctgcaccag |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
43212214 |
agaaagctagatatggcaagcggtggttctccgacaggtgcaagtggttcgggccacggtccaaattgggactataactggggatggggatctgcaccag |
43212115 |
T |
|
| Q |
316 |
gaagtgggtggggttacggttcaggttcaggacattctccttctggctttggtagaggttatggctatggttttggaaccgggtc |
400 |
Q |
| |
|
| || |||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43212114 |
gtagcgggtggggatatggttcaggttcaggacattctccttctggctttggtagaggttatggctatggttttggaaccgggtc |
43212030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University