View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5183_high_8 (Length: 454)
Name: NF5183_high_8
Description: NF5183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5183_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 203 - 440
Target Start/End: Original strand, 33454382 - 33454627
Alignment:
| Q |
203 |
tgagtgtacctggtaaagagcatcactttgtagaagactcttgtgaccaacttcttggtgtcttccagattcagtttgcttttgatcttcgttggttgcc |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33454382 |
tgagtgtacctggtaaagagcatcactttgtagaagactcttgtgaccaacttcttggtgtcttccagattcagtttgattttgatcttcgttggttgcc |
33454481 |
T |
|
| Q |
303 |
attgttaaattcttggaatgttttgcttctttttctgttactgctatgt--------gttgaatggagcttggttagagaagaggtaggaagagggttat |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33454482 |
attgttaaattcttggaatgttttgcttctttttctgtttctgctatgtgttgaagagttgaatggagcttggttagagaagaggtaggaagagggttat |
33454581 |
T |
|
| Q |
395 |
ataagggagggaaaaaccggtatggttaaggaaaattggtgtgatg |
440 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33454582 |
ataagggagggaaaaaccggtatggttaaggaaaattggtgtgatg |
33454627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 18 - 132
Target Start/End: Original strand, 33454187 - 33454302
Alignment:
| Q |
18 |
aaattaacatgaa-ttgagaattattaccatgggtgttttgctgtgacctctctcaactctttcatggcttcatgttctcttgggaagacactggtgtct |
116 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33454187 |
aaattaacatgaaattgagaattattaccatgggtgttttgctgtgacctctctcaactctttcatggcttcatgttctcttgggaagacactggtctct |
33454286 |
T |
|
| Q |
117 |
agaatatactgtacat |
132 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
33454287 |
agaatatactgtacat |
33454302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University