View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5183_low_32 (Length: 228)

Name: NF5183_low_32
Description: NF5183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5183_low_32
NF5183_low_32
[»] chr2 (1 HSPs)
chr2 (25-221)||(16701789-16701985)


Alignment Details
Target: chr2 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 25 - 221
Target Start/End: Original strand, 16701789 - 16701985
Alignment:
25 gataaaaagctaattcttttgagacaagattcattacccttttgctctataattgattcaattttagtaataccctttataagctcaaggttgcttgagc 124  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |||||||||||||||||||||||||||||    
16701789 gataaaaagctaattcttttgagacaagattcattacccttttgctctataattgattcaattgtactaaaaccctttataagctcaaggttgcttgagc 16701888  T
125 tggattcactcnnnnnnngagaggcctctttaatttataaattctaatgcactttggtggatgtgacacgttgggaaaatagttatgtcctttgctt 221  Q
    |||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16701889 tggattcactcaaaaaaagagaggcctctttaatttataaattctaatgcactttggtggatgtgacacgttgggaaaatagttatgtcctttgctt 16701985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University