View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5183_low_34 (Length: 205)
Name: NF5183_low_34
Description: NF5183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5183_low_34 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 13 - 192
Target Start/End: Complemental strand, 1850424 - 1850239
Alignment:
| Q |
13 |
attatactacatggatggtgtctaatataagctagctattattctttacatgaaat----actacctttttagaaagnnnnnnnnnngtaaggattaagg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
1850424 |
attatactacatggatggtgtctaatataagctagctattattctttacatgaaatcagcactacctttttagaaagaaaaaaaaaagtaaggattaagg |
1850325 |
T |
|
| Q |
109 |
gaatagaaaataaatatgatacaggctttggaagatgggcaggagagtttagaactgatatata--tatagtgagagacattgaat |
192 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1850324 |
gaatagaaaataaatatgatacaggttttggaagatgggcaggagagtttagaactgatatatatatatagtgagagacattgaat |
1850239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University