View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5183_low_4 (Length: 547)
Name: NF5183_low_4
Description: NF5183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5183_low_4 |
 | |
|
| [»] scaffold0140 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0140 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 305
Target Start/End: Complemental strand, 37222 - 36933
Alignment:
| Q |
18 |
aaaggcagcaactcagaaccagacattgccac-atgactttattgatgacacaactcatgttattactggtttgttgaaatgtcaaaagaa-tattgcaa |
115 |
Q |
| |
|
||||| |||||||||||||||| ||||||||| || | || |||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37222 |
aaaggaagcaactcagaaccagccattgccaccatcaaatt-ttgatgacacaactgatgttattactggtttgttgaaatgtcaaaagaaatattgcaa |
37124 |
T |
|
| Q |
116 |
aagtt-caaggcaagaaggtcatgactgttgggggtccatcagagactcaagctgaagcaatgttgagagacctgaagatgcttccaccagaggaactag |
214 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37123 |
aagttacaaggcaagaaggtcatgactgttgggggtccatcagagagtcaagctgaagcaatgttgagagacctgaagatgcttccaccagaggaactag |
37024 |
T |
|
| Q |
215 |
agaaggttacaagggagttggtgacaggcctagtgaattggaatgagaatattcacaagaacaaccaagcaaaaggaactgatggggagga |
305 |
Q |
| |
|
| |||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
37023 |
aaaaggttacaagggagttggtcacaggtctagtgaattggaatgagaatattcagaagaacaaccaagcaaaaggaactgatgggaagga |
36933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 376 - 443
Target Start/End: Complemental strand, 36900 - 36833
Alignment:
| Q |
376 |
ttaatgtttaagttttactttactttttggctatgaacctattagttgcactatgatggttatgttga |
443 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36900 |
ttaatgtttaagttttactttactttttggctatgaacctattagttgcactatgatgcttatgttga |
36833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University