View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5184_low_10 (Length: 240)
Name: NF5184_low_10
Description: NF5184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5184_low_10 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 47 - 240
Target Start/End: Complemental strand, 31981179 - 31980986
Alignment:
| Q |
47 |
aatccaaattgtaacaccttgctagaccattataatcatagttctaaaatgtggtctgaaattgcagtcgtaatataacaattctagcgatctctgcaac |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |||||| || |||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
31981179 |
aatccaaattgtaacaccttgctagaccattagaatcatagttctaaattgtggtttgtaattgcagtcgtaatataacaattttagcaatctctgcaac |
31981080 |
T |
|
| Q |
147 |
ggtatcacaattgggatggtggtcgcattgaccatttttgcttacattttattgcagtgcaaccgcaactgcaatttaaaaccatgactagaat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31981079 |
ggtatcacaattgggatggtggtcgcattgaccatttttgcttacattttattgcagtgcaaccgcaactgcaatttaaaaccatgactagaat |
31980986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University