View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5184_low_11 (Length: 237)
Name: NF5184_low_11
Description: NF5184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5184_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 9221762 - 9221987
Alignment:
| Q |
1 |
cataccagtctcatgaaggtttcaaagaagagcaatggctccataaacatatcaatattcctgaattaggcacaaaaatgtatgtcattaaactgtaaga |
100 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9221762 |
cataccagtctcatgaagggttccaagaagagcaatggctccataaacatatcaatattcctgaattaggcacaaaaatgtatgtcattaaactgtaagc |
9221861 |
T |
|
| Q |
101 |
aatcttgattagttaaaaaaccacaatgatttaaattgttgttttcatccttctattttgggaaaaccgccgttttgctccccctatttctaatcataaa |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9221862 |
aatcttgattagttgaaaaaccacaatgatttaaa-tgttgttttcatccttctattttgggaaaaccgccgttttgctccccctatttctaatcataga |
9221960 |
T |
|
| Q |
201 |
attttggtccccc-tttcatttgatga |
226 |
Q |
| |
|
||||||||||||| ||||||||||||| |
|
|
| T |
9221961 |
attttggtcccccgtttcatttgatga |
9221987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University