View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5184_low_4 (Length: 334)
Name: NF5184_low_4
Description: NF5184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5184_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 41 - 321
Target Start/End: Complemental strand, 13484563 - 13484283
Alignment:
| Q |
41 |
tgtgggaagtgcaatgattttattgaagttaactgagtttttacattcaattcacacactctatgttccaactgtaaccgaaaaaggaatttggcggctg |
140 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13484563 |
tgtgggaagtgcaatgattttatagaagttaactgagtttttacattcaattcacacactctatgttccaactgtaaccgaaaatggaatttggcggctg |
13484464 |
T |
 |
| Q |
141 |
taatgtgtagtcactaacttttttaatctgaatactgcagtaaggattttatatggagttggctaaggaggcttgttgaacaataaaaggcttgtatggt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13484463 |
taatgtgtagtcactaacttttttaatctgaatactgcagtaaggattttatatggagttggctaaggaggcttgtagaacaataaaaggcttgtatggt |
13484364 |
T |
 |
| Q |
241 |
cttgtgtgtgagcaatctcttgtgatgaagtctgtcatacacggttgaaaaggattggaagcattaacttgtatagtttct |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
13484363 |
cttgtgtgtgagcaatctcttgtgatgaagtctgtcatacacggttgaaaaagattggaagcattaactcgtatagtttct |
13484283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 129 - 198
Target Start/End: Complemental strand, 13489380 - 13489311
Alignment:
| Q |
129 |
atttggcggctgtaatgtgtagtcactaacttttttaatctgaatactgcagtaaggattttatatggag |
198 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13489380 |
atttggctgctgtaatgtgtagtcactaacttttttaatctgaatactgcagtaaggattgtatatggag |
13489311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 225 - 281
Target Start/End: Complemental strand, 13489304 - 13489248
Alignment:
| Q |
225 |
aaaaggcttgtatggtcttgtgtgtgagcaatctcttgtgatgaagtctgtcataca |
281 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
13489304 |
aaaaggcttttatggccttgtgtgtgagcaatcttttgtgatgaagtctatcataca |
13489248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University