View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5184_low_9 (Length: 248)
Name: NF5184_low_9
Description: NF5184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5184_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 9221630 - 9221418
Alignment:
| Q |
1 |
ttgaagataagttcattaacaggatcagaatatgggaataagggaaaaagaattgtgcttgctgtgatatctctggttgccttattattcttcttcatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9221630 |
ttgaagataagttcattaacaggatcagaatatgggaataagggaaaaagaattgtgcttgctgtgatatctctggttgccttattattcttcttcatga |
9221531 |
T |
|
| Q |
101 |
aactagctttataaaagccttgtcatgaatcatgccatgctccatttgttaactttaggtacannnnnnnatgcaaaaataattttattaatagagaaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9221530 |
aactagctttataaaagccttgtcatgaatcatgccatggtccatttgttaactttaggtacatttttttatgcaaaaataattttattaatagagaaaa |
9221431 |
T |
|
| Q |
201 |
aataaaaccatag |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
9221430 |
aataaaaccatag |
9221418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University