View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5186-Insertion-5 (Length: 215)
Name: NF5186-Insertion-5
Description: NF5186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5186-Insertion-5 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 8 - 215
Target Start/End: Original strand, 2486159 - 2486366
Alignment:
| Q |
8 |
gattgaatattgccaactagagcactgcttgaaagggcccataattaaatttatttattattagtcatttagttgtgattatgaatgatgatgttaaagt |
107 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2486159 |
gattgaatattgccaacgagagcactgcttgaaagggcccataattaaatttatttattattagtcatttagttgtgattatgaatgatgatgttatagt |
2486258 |
T |
|
| Q |
108 |
ggagtgaatgtcatgtaactcaactggggggagaggaattgtttctgttctattgcaaattgtgaacattgtcttttatttagattattgataatttttg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2486259 |
ggagtgaatgtcatgtaactcaactggggggagatgaattgtttctgttctattgcaaattgtgaacattgtcttttatttagattattggtaatttttg |
2486358 |
T |
|
| Q |
208 |
tgccactg |
215 |
Q |
| |
|
|||||||| |
|
|
| T |
2486359 |
tgccactg |
2486366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University