View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5186-Insertion-8 (Length: 74)

Name: NF5186-Insertion-8
Description: NF5186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5186-Insertion-8
NF5186-Insertion-8
[»] chr3 (2 HSPs)
chr3 (8-74)||(54396109-54396175)
chr3 (10-53)||(54381246-54381289)


Alignment Details
Target: chr3 (Bit Score: 67; Significance: 2e-30; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 8 - 74
Target Start/End: Complemental strand, 54396175 - 54396109
Alignment:
8 caccactcccaccagaggccacccactgaaccaaagggaactagttgatcatatttctatgtcattc 74  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54396175 caccactcccaccagaggccacccactgaaccaaagggaactagttgatcatatttctatgtcattc 54396109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 54381289 - 54381246
Alignment:
10 ccactcccaccagaggccacccactgaaccaaagggaactagtt 53  Q
    ||||||||||||||||||||| ||||||| | ||||||||||||    
54381289 ccactcccaccagaggccaccaactgaacaagagggaactagtt 54381246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University