View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5186-Insertion-8 (Length: 74)
Name: NF5186-Insertion-8
Description: NF5186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5186-Insertion-8 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 2e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 8 - 74
Target Start/End: Complemental strand, 54396175 - 54396109
Alignment:
| Q |
8 |
caccactcccaccagaggccacccactgaaccaaagggaactagttgatcatatttctatgtcattc |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54396175 |
caccactcccaccagaggccacccactgaaccaaagggaactagttgatcatatttctatgtcattc |
54396109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 54381289 - 54381246
Alignment:
| Q |
10 |
ccactcccaccagaggccacccactgaaccaaagggaactagtt |
53 |
Q |
| |
|
||||||||||||||||||||| ||||||| | |||||||||||| |
|
|
| T |
54381289 |
ccactcccaccagaggccaccaactgaacaagagggaactagtt |
54381246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University