View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5186-Insertion-9 (Length: 73)
Name: NF5186-Insertion-9
Description: NF5186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5186-Insertion-9 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 61; Significance: 6e-27; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 6e-27
Query Start/End: Original strand, 5 - 73
Target Start/End: Complemental strand, 44095222 - 44095154
Alignment:
| Q |
5 |
acaacatgcacaatacttcattttctaatatggataaactcatattcaactcttgcattgcatactttc |
73 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44095222 |
acaacatgcacaatatttcattttctaagatggataaactcatattcaactcttgcattgcatactttc |
44095154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.000000000005
Query Start/End: Original strand, 38 - 73
Target Start/End: Complemental strand, 44069940 - 44069905
Alignment:
| Q |
38 |
ataaactcatattcaactcttgcattgcatactttc |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
44069940 |
ataaactcatattcaactcttgcattgcatactttc |
44069905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.000000000005
Query Start/End: Original strand, 38 - 73
Target Start/End: Original strand, 44085165 - 44085200
Alignment:
| Q |
38 |
ataaactcatattcaactcttgcattgcatactttc |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
44085165 |
ataaactcatattcaactcttgcattgcatactttc |
44085200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University