View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5186_high_15 (Length: 240)
Name: NF5186_high_15
Description: NF5186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5186_high_15 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 37663744 - 37663966
Alignment:
| Q |
18 |
aatttaagccattaaatggaaactgggtgcacgttaactaacccaagaatataaatacgaataaagacggcagagtcaaggcctgcatgatcaataagct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37663744 |
aatttaagccattaaatggaaactgggtgcacgttaactaacccaagaatataaatacgaataaagacggcagagtcaaggcctgcatgatcaataagct |
37663843 |
T |
|
| Q |
118 |
caggttcaggcatatgcaatgctgcaggcatccaattgaggaacctaatgtaggttccaaagtcaaggttaacaaatttcttgacaattgatctggaatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37663844 |
caggttcaggcatatgcaatgctgcaggcatccaattgaggaacctaatgtaggttccaaagtcaaggttaacaaatttcttgacaattgatctggaatt |
37663943 |
T |
|
| Q |
218 |
tgttgggctgcttcttatcccct |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37663944 |
tgttgggctgcttcttatcccct |
37663966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University