View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5186_high_16 (Length: 240)
Name: NF5186_high_16
Description: NF5186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5186_high_16 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 110 - 240
Target Start/End: Complemental strand, 47118751 - 47118613
Alignment:
| Q |
110 |
taatgttataacgttgatgtaattaaaaaagataacgactcatagtctcatattg--------gttctctatttttaccattttgcataatttgtcccac |
201 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
47118751 |
taatgttataatgttgatgtaattaaaaaagataacgactcatagtctcatattgcagttttggttttctatttttaccattttgcataatttatcccac |
47118652 |
T |
 |
| Q |
202 |
tattttgaaatccaacagtttttgttcttcgatcgtatt |
240 |
Q |
| |
|
|||||| ||||||||||||||| || | ||||||||||| |
|
|
| T |
47118651 |
tattttaaaatccaacagttttggtccctcgatcgtatt |
47118613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 18 - 99
Target Start/End: Complemental strand, 47118879 - 47118798
Alignment:
| Q |
18 |
gcattaccaatctcacttatgtgtcttcgagctagctttcaatctattacatatatacaaaggaatgaggaattttggaata |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47118879 |
gcattaccaatctcacttatgtgtcttcgagctagctttgaatctattacatatatacaaaggaatgaggaattttggaata |
47118798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 223
Target Start/End: Complemental strand, 25189706 - 25189653
Alignment:
| Q |
170 |
ctatttttaccattttgcataatttgtcccactattttgaaatccaacagtttt |
223 |
Q |
| |
|
||||||||||||||||||| |||| ||||| ||||||| |||| |||||||||| |
|
|
| T |
25189706 |
ctatttttaccattttgcagaattggtccccctattttaaaattcaacagtttt |
25189653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University