View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5186_high_7 (Length: 251)
Name: NF5186_high_7
Description: NF5186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5186_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 37663960 - 37664199
Alignment:
| Q |
1 |
atccccttcagataccattttgggaagtaaaccctatcattgaaaggctgaagtcgcaacactgcaaacgctaaaaggaacatagttgcggaaaacagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37663960 |
atccccttcagataccattttgggaagtaaaccctatcattgaaaggctgaagtcgcaacactgcaaacgctaaaaggaacatagttgcggaaaacagat |
37664059 |
T |
|
| Q |
101 |
tgatgccagcagaaacgccaatatcgactagagttgccattttcttctccctttaaaacacactttaacctacacatatttnnnnnnntaagtcatgaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37664060 |
tgatgccagcagaaacgccaatatcgactagagttgccattttcttctccctttaaaacacactttaacctacacatatttaaaaaaataagtcatgaaa |
37664159 |
T |
|
| Q |
201 |
ttggctttccgatttcaagtagcatgacttctaaattcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37664160 |
ttggctttccgatttcaagtagcatgacttctaaattcat |
37664199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 53
Target Start/End: Original strand, 55427917 - 55427966
Alignment:
| Q |
4 |
cccttcagataccattttgggaagtaaaccctatcattgaaaggctgaag |
53 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
55427917 |
cccttgagataccattttgggaagtataccctatcattcaaaggctgaag |
55427966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University