View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5186_low_20 (Length: 211)
Name: NF5186_low_20
Description: NF5186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5186_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 576812 - 576632
Alignment:
| Q |
18 |
atgaacaatgagccaacaaaatttaagtccaccaaccaatcaagaagctcaaggctgtcatgaatgacaatattgctttagaatgactgttagcaacagc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
576812 |
atgaacaatgagccaacaaaatttaagtccaccaaccaatcaagaagctcaaggctgtcatgaatgacaatattgctttagaatgactgttagcaacagc |
576713 |
T |
 |
| Q |
118 |
tacattttttctcattattggga---catcatagacaagagtcatattgggtcggaacaacccgaaattcctttcacatat |
195 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
576712 |
tacattttttctcattattgggacgtcatcatagacaagagtcatgttgggtcggaacaacccaaaattcctttcacatat |
576632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University