View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5188-Insertion-5 (Length: 167)
Name: NF5188-Insertion-5
Description: NF5188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5188-Insertion-5 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 5e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 8 - 167
Target Start/End: Original strand, 31802220 - 31802379
Alignment:
| Q |
8 |
ttgtgcatataattgaattaggtaactttccccatcttatggtaatctgttgtggctgcaattggaaatattgtgttggagctgattttggtttctgtta |
107 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31802220 |
ttgtgcatataattgaattaggtaattttcctcatcttatggtaatctgttgtggctgcaattggaaatattgtgttggagctgattttggtttctgtta |
31802319 |
T |
|
| Q |
108 |
tctttatatcagtggagtcatggtccatttaagtatcattaagagctaatatgatggtgg |
167 |
Q |
| |
|
| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31802320 |
tttttataacagtggagtcatggtccatttaagtatcattaagagctaatatgatggtgg |
31802379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University