View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5188-Insertion-7 (Length: 273)
Name: NF5188-Insertion-7
Description: NF5188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5188-Insertion-7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 6 - 254
Target Start/End: Original strand, 49951648 - 49951896
Alignment:
| Q |
6 |
caaaaggaaggcagaattaaaatggaaaaaatcgaggggataggaaagtttcagttgatatcgaacttgtcgtttgttaattcccatagatcccacagct |
105 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49951648 |
caaaaggaaggtagaattaaaatggaaaaaatcgaggggataggaaagtttcagttgatatcgaacttgtcgtttgttaattcccatagatcccacagct |
49951747 |
T |
|
| Q |
106 |
ccaagccaaagtagctgagcgtgtgaatgatctcaaaaggtgtccttagttactgttgtagtaaaaatttaacataaaaaccaaaataaatccaaaccac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49951748 |
ccaagccaaagtagctgagcgtgtgaatgatctcaaaaggtgtccttagttactgttgtagtaaaaatttaacataaaaaccaaaataaaaccaaaccac |
49951847 |
T |
|
| Q |
206 |
attnnnnnnnnnnnnnnatgactcatcatcacccccttagcatctgtca |
254 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49951848 |
atttctctctctctctcatgactcatcatcacccccttagcatctgtca |
49951896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University