View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5188_high_7 (Length: 249)
Name: NF5188_high_7
Description: NF5188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5188_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 245
Target Start/End: Complemental strand, 6476891 - 6476664
Alignment:
| Q |
18 |
atactattcctgcatgctttggttgtttatttcttgaaagaaagaaatattaccactaacattacctttctctttaatgatttataggtagtaacattct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6476891 |
atactattcctgcatgctttggttgtttatttcttggaagaaagaaatattatcactaacactacctttctctttaatgatttataggtagtaacattct |
6476792 |
T |
|
| Q |
118 |
gggaaggggagattgtcgataccaagaattatactttcttcaccggcaaatgggaggcagcgtatgttgttatgcaataacaattaaatcaagcatgaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6476791 |
gggaaggggagattgtcgataccaagaattatactttcttcaccggcaaatgggaggcagcgtatgttgttatgcaataacaattaaatcaagcatgaaa |
6476692 |
T |
|
| Q |
218 |
cataagttgaataatactgatgatgtcc |
245 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
6476691 |
cataagttgaataatactgatgacgtcc |
6476664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University