View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5188_high_8 (Length: 247)
Name: NF5188_high_8
Description: NF5188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5188_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 112 - 236
Target Start/End: Complemental strand, 43918308 - 43918184
Alignment:
| Q |
112 |
ttaagtctaaattgccgtaagcatgctgagcgcattattcttcttgttgagatgttgcaggtaatataaatgttagctcctgttgcactcctcgtgtcat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43918308 |
ttaagtctaaattgccgtaagcatgctgagcgcattattcttcttgttgagatgttgcaggtaatataaatgttagctcctgttgcactcctcgtgtcat |
43918209 |
T |
 |
| Q |
212 |
cgaatatatatcctgcctatgttac |
236 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43918208 |
cgaatatatatcctgcctatgttac |
43918184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 130 - 182
Target Start/End: Original strand, 39128772 - 39128824
Alignment:
| Q |
130 |
aagcatgctgagcgcattattcttcttgttgagatgttgcaggtaatataaat |
182 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39128772 |
aagcatgctgagcgtattattcttcttgttgagatgttgcaggtaatataaat |
39128824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University