View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5189_high_11 (Length: 340)
Name: NF5189_high_11
Description: NF5189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5189_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 13 - 322
Target Start/End: Complemental strand, 56277641 - 56277329
Alignment:
| Q |
13 |
cagagatagatggttggatttggggaaggaaaacaggtacggcagcaaagaattcctttacaagatgacaaaagcacaacatcttgaggaagaaaagaaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || | ||||| ||||||||||||||||||||||||| |
|
|
| T |
56277641 |
cagagatagatggttggatttggggaaggaaaacaggtacggcagcaaacaattcctttacaggaagccaaaacaacaacatcttgaggaagaaaagaaa |
56277542 |
T |
|
| Q |
113 |
aaacattgtggtgaacaactagtttagcagcgtt---tttgggttggacaggaatgtaactaatggttttaacatcgtgtttgcagaacatgtacctatc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56277541 |
aaacattgtggtgaacaactagtttagcagcgttgtttttgggttccacaggaatgtaactaatggttttaacatcgtgtttgcagaacatgtacctatc |
56277442 |
T |
|
| Q |
210 |
ttgaacaataaaagcatttaaaacaagattagtgtttttgagttgatctttgatgaatgaacggcttgaaatgatgttgttccaccctctggaaatgcat |
309 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
56277441 |
ttgaacaataaaaccatttaaaacaagatttgtgtttttgagttgatctttgatgaatgaacggcttgaaatgatgtggttccaacctctggaaatgcat |
56277342 |
T |
|
| Q |
310 |
ttcatgctaagca |
322 |
Q |
| |
|
||||||||||||| |
|
|
| T |
56277341 |
ttcatgctaagca |
56277329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University