View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5189_high_12 (Length: 339)
Name: NF5189_high_12
Description: NF5189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5189_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 189 - 322
Target Start/End: Complemental strand, 34967131 - 34966998
Alignment:
| Q |
189 |
gctatattgtgagagtcaatgtatgtggtggtcatacaatgacggtgtatggatcagaatgttggtatgctgagagacaacatgcaaagaaaggacaccc |
288 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34967131 |
gctatattgtgagagtcaatgtatgcggtgatcatacaatgacggtgtatggatcagaatgttggtatgctgagagacaacatgcatagaaaggacaccc |
34967032 |
T |
 |
| Q |
289 |
acttaatgataaattttattagtaatgacgaaag |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34967031 |
acttaatgataaattttattagtaatgacgaaag |
34966998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 49 - 196
Target Start/End: Complemental strand, 18426326 - 18426180
Alignment:
| Q |
49 |
gaaaagcttaagaggagctgaaatgatgtaagccattgtttctactttgaattgcatattcatgttttgctcctgattgacgttgtccatactgttttaa |
148 |
Q |
| |
|
||||| || ||||| ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
18426326 |
gaaaaactcaagagaagctgaaatgatgtaagcctgtatttctactttgaattgcatattcatgttttgctcctgtttgacgttgtccatactg-tttaa |
18426228 |
T |
 |
| Q |
149 |
ttgtcagttttgcttttatttctttaataagaataagaatgctatatt |
196 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
18426227 |
ttgtcagttttggttttagttctttaataagaataagagtgctatatt |
18426180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 197 - 267
Target Start/End: Complemental strand, 18425429 - 18425359
Alignment:
| Q |
197 |
gtgagagtcaatgtatgtggtggtcatacaatgacggtgtatggatcagaatgttggtatgctgagagaca |
267 |
Q |
| |
|
||||| ||||||| |||||||| |||| |||| | |||| ||||||||||||| ||| ||||||||||||| |
|
|
| T |
18425429 |
gtgagtgtcaatgaatgtggtgatcatccaattatggtgcatggatcagaatgctgggatgctgagagaca |
18425359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University