View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5189_low_13 (Length: 322)
Name: NF5189_low_13
Description: NF5189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5189_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 1 - 313
Target Start/End: Complemental strand, 47287041 - 47286729
Alignment:
| Q |
1 |
ccatcaccatctccattacaatcattattatcatcaccctctagcaatcaaggagaatgggaactaatacaaccaaccattggcatttcagctatgcaca |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47287041 |
ccatcaccatctccattaccatcattattatcatcaccctctagcaatcaaggagaatgggaactaatacaaccaaccattggcatttcagctatgcaca |
47286942 |
T |
 |
| Q |
101 |
tgcaactttcacacaacaataaaatcataattttcgatcgaaccgattttggcccttcaaatctccctctttcaaatggccggtgtcgtatggatccatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286941 |
tgcaactttcacacaacaataaaatcataattttcgatcgaaccgattttggcccttcaaatctccctctttcaaatggccggtgtcgtatggatccatt |
47286842 |
T |
 |
| Q |
201 |
cgacactgcccttaaaattgattgcactgctcactctgttctatacgacattgccacaaatacattccgatccttaactgtacaaacagacacttggtgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286841 |
cgacactgcccttaaaattgattgcactgctcactctgttctatacgacattgccacaaatacattccgatccttaactgtacaaacagacacttggtgt |
47286742 |
T |
 |
| Q |
301 |
tccacaggttctg |
313 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
47286741 |
tcctcaggttctg |
47286729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University