View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5190-Insertion-12 (Length: 233)
Name: NF5190-Insertion-12
Description: NF5190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5190-Insertion-12 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 21 - 233
Target Start/End: Original strand, 50538210 - 50538420
Alignment:
| Q |
21 |
atgatcgtggcagttaatttgttgaacaattttcagcagatcatacgctataaattggcacacattcataaattggtatctgcaaattggtattccatcg |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50538210 |
atgatcgtggcagttaatttgttgaacaattttcagcagatcatacgctataaattgacacacattcataaattgatatctgcaaattggtattccatcg |
50538309 |
T |
|
| Q |
121 |
aattggtgtgatttaacgcaccatgtgtcaaatggccatgttctccactatatgtatctataggaagaacacgtggctcgatattccccatagtttaact |
220 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50538310 |
aattggtgtgatttaacgcacc--gtgtcaaatggccacgttctccactatatgtatctataggaagaacacgtggctcgatattccccatagtttaact |
50538407 |
T |
|
| Q |
221 |
atttttgtctgcc |
233 |
Q |
| |
|
||||||||||||| |
|
|
| T |
50538408 |
atttttgtctgcc |
50538420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University