View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5190_high_45 (Length: 238)
Name: NF5190_high_45
Description: NF5190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5190_high_45 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 15149004 - 15148944
Alignment:
| Q |
178 |
gagatggatttagagacggatgtttacagagacaaaatttgagtcgaacaactaggtttct |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15149004 |
gagatggatttagagacggatgtttacagagacaaaatttgagtcgaacaattaggtttct |
15148944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 81 - 145
Target Start/End: Complemental strand, 15150486 - 15150422
Alignment:
| Q |
81 |
aatcatacaaaattgtttctttcactctcatgattcnnnnnnncaaggtgattctttcttcccta |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15150486 |
aatcatacaaaattgtttctttcactctcatgattctttttttcaaggtgattctttcttcccta |
15150422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University