View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5190_low_16 (Length: 405)
Name: NF5190_low_16
Description: NF5190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5190_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 26 - 396
Target Start/End: Complemental strand, 44861529 - 44861151
Alignment:
| Q |
26 |
atgtaataaagatggttaaattgttggttacttttcatgtttagtttttgataagcaagtttttatatttattgattgata--------tgattatacta |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44861529 |
atgtaataaagacggttaaattgttggttacttttcatgtttagtttttgataagcaagtttttatatttattgattgatgacttgtgttgattatacta |
44861430 |
T |
 |
| Q |
118 |
taggatcgttatgttgtgatgatcctggtggaagatgatacgagtgtacaaattacacgctacactgataaaaaccggacaacaccaaaacccacattct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44861429 |
taggatcgttatgttgtgatgatcctggtggaagatgatacgagtgtacaaattacacgctacactgataaaaaccggacaacaccaaaacccacattct |
44861330 |
T |
 |
| Q |
218 |
ctccgtcccttcttcctcacctgctccaactaccccgccgccgcacgctatgccgccaccgtcttactccgcctccccactccaccggacccattctcct |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44861329 |
ctccgtcccttcttcctcacctgctccaactaccccgccgccgcacgctatgccgccaccgtcttactccgcctccccactccaccggacccattctcct |
44861230 |
T |
 |
| Q |
318 |
acaacaccatcatcaaacacgtctcacccaccggggccatttcccttttttcccatatgcaccgtaactccgtcccctt |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44861229 |
acaacaccatcatcaaacacgtctcacccaccggggccatttcccttttttcccatatgcaccgtaactccgtcccctt |
44861151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University