View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5190_low_17 (Length: 400)
Name: NF5190_low_17
Description: NF5190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5190_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 108 - 380
Target Start/End: Complemental strand, 40953904 - 40953629
Alignment:
| Q |
108 |
ataaaataactttatgtattacta---tttgtcggctcttcttgggatcaatcggttgtctttgtaacgtctgaccaaattttatcaggttaagagtcgg |
204 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40953904 |
ataaaataactttatgtattactactatttgtcggctcttcttgggatcaatcggttgtctttgtaacgtctgaccaaattttatcaggttaagagtcgg |
40953805 |
T |
 |
| Q |
205 |
gtttaagtttaaatttaaaaaattggtcatgtttaatgttatagaggctagggcgaaaaacacacaaaattcgacttaggtcctttgtacatccctggtt |
304 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40953804 |
gtttaagtttaaaattaaaaaattggtcatgtttaatattatagaggctagggcgaaaaacacacaaaattcgacttaggtcctttgtacatccctagtt |
40953705 |
T |
 |
| Q |
305 |
gtgacttgtgaattcaattccctacaacttttgggatagttttataattcttctctagttcttcctaataattctt |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40953704 |
gtgacttgtgaattcaattccctacaacttttgggatagttttataattcttctctagttcttcctaataattctt |
40953629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University