View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5190_low_31 (Length: 324)
Name: NF5190_low_31
Description: NF5190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5190_low_31 |
 |  |
|
| [»] scaffold0072 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0072 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 19 - 312
Target Start/End: Complemental strand, 24495 - 24202
Alignment:
| Q |
19 |
gtatggtgagttaggctcaacacaaattctaagatctatcaatagaaatgaagtacataaagatgctctttggtacaaacaaagttcattcgaagcacgg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24495 |
gtatggtgagttaggctcaacacaaattctaagatctatcaatagaaataaagtacataaagatgctctttggtacaaacaaagttcattcgaagcacgg |
24396 |
T |
 |
| Q |
119 |
tgacagaaattattaagcacaagtcaccaacattaaaatcataacttgctgacttattttctattcttagtgaaagtgtataagaataaacgtacttctc |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24395 |
tgacagaaattattaaacacaagtcaccaacattaaaagcataacttgctgacttattttctattcttagtgaaagtgtataagaataaacgtacttctc |
24296 |
T |
 |
| Q |
219 |
atatggaagatcagaacatttccaatttgcatctgacacagcatcatggtgaatgcggcattcctctttagatctcagacgaaatctacgctct |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24295 |
atatggaagatcagaacatttccaatttgcatctgacacagcatcatggtgaatgcggcattcctctttagatctcagacgaaatctgcgctct |
24202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 211 - 296
Target Start/End: Complemental strand, 38153049 - 38152964
Alignment:
| Q |
211 |
tacttctcatatggaagatcagaacatttccaatttgcatctgacacagcatcatggtgaatgcggcattcctctttagatctcag |
296 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||| | | ||||||||||||| ||| ||||||||||||| |||||| |
|
|
| T |
38153049 |
tacttgtcatatggaagatcagaacatttccaatttggatcagctaaagcatcatggtgatggcgacattcctctttagttctcag |
38152964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University