View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5190_low_50 (Length: 238)

Name: NF5190_low_50
Description: NF5190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5190_low_50
NF5190_low_50
[»] chr2 (2 HSPs)
chr2 (178-238)||(15148944-15149004)
chr2 (81-145)||(15150422-15150486)


Alignment Details
Target: chr2 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 15149004 - 15148944
Alignment:
178 gagatggatttagagacggatgtttacagagacaaaatttgagtcgaacaactaggtttct 238  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
15149004 gagatggatttagagacggatgtttacagagacaaaatttgagtcgaacaattaggtttct 15148944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 81 - 145
Target Start/End: Complemental strand, 15150486 - 15150422
Alignment:
81 aatcatacaaaattgtttctttcactctcatgattcnnnnnnncaaggtgattctttcttcccta 145  Q
    ||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||    
15150486 aatcatacaaaattgtttctttcactctcatgattctttttttcaaggtgattctttcttcccta 15150422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University