View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5192-Insertion-12 (Length: 109)
Name: NF5192-Insertion-12
Description: NF5192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5192-Insertion-12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 2e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 2e-34
Query Start/End: Original strand, 5 - 105
Target Start/End: Original strand, 14785310 - 14785411
Alignment:
| Q |
5 |
acatttgctttataggttcttgctatcc-tacacctatagaaacaaatgggtatgaaaatattggttagggaggaaccaacactagggatttcacaattc |
103 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||| ||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
14785310 |
acatttgctttacaggttcttgctatccctacacgtatagaaacaaatggatatgaaaatattggctagggaggaaccaacactagggatttcataattc |
14785409 |
T |
|
| Q |
104 |
aa |
105 |
Q |
| |
|
|| |
|
|
| T |
14785410 |
aa |
14785411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 2e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 8 - 105
Target Start/End: Complemental strand, 48898677 - 48898579
Alignment:
| Q |
8 |
tttgctttataggttcttgctatcc-tacacctatagaaacaaatgggtatgaaaatattggttagggaggaaccaacactagggatttcacaattcaa |
105 |
Q |
| |
|
||||||||| ||||||||||||||| | |||||| ||| || |||| ||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48898677 |
tttgctttacaggttcttgctatccctgcacctaaagacactgatggacttgacaatattggttggggaggaaccaacactagggatttcacaattcaa |
48898579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000004; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000004
Query Start/End: Original strand, 8 - 102
Target Start/End: Original strand, 38061945 - 38062040
Alignment:
| Q |
8 |
tttgctttataggttcttgctatcc-tacacctatagaaacaaatgggtatgaaaatattggttagggaggaaccaacactagggatttcacaatt |
102 |
Q |
| |
|
||||||||| |||||||| |||||| | |||||| ||| || |||| ||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38061945 |
tttgctttacaggttctttctatccctgcacctaaagacactgatggacttgacaatattggttggggaggaaccaacactagggatttcacaatt |
38062040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.0000000005
Query Start/End: Original strand, 61 - 105
Target Start/End: Complemental strand, 31116262 - 31116218
Alignment:
| Q |
61 |
aatattggttagggaggaaccaacactagggatttcacaattcaa |
105 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
31116262 |
aatattggttgcggtggaaccaacactagggatttcacaattcaa |
31116218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University