View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5192_high_10 (Length: 331)
Name: NF5192_high_10
Description: NF5192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5192_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 17 - 324
Target Start/End: Complemental strand, 40642748 - 40642441
Alignment:
| Q |
17 |
agattgaaatcaattctctcaataagaattattcttgaattttcttgaagcacttttgtgtgagggagccagggattttagaggttactgcttgtgcagc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
40642748 |
agattgaaatcaattctctcaataagaattattcttgaattttcttgaagcacttttgtgtgagggagccagggattttagaggttactacttgtgcatc |
40642649 |
T |
|
| Q |
117 |
tattattagctgggttgtatgttgttattagacctacatgggaagataggcagacttggtcccttaattgaacgggaattttacagttaaatcttcttat |
216 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40642648 |
tattattagctgggttgtgtgttgttattagacctacatgggaagataggcagacttggtcccttaattgaacgggaattttacagttaaatcttcttat |
40642549 |
T |
|
| Q |
217 |
ttcttgatttctaaggagttgttgagtgtgacaaatcgacgcttgctaaagataaatgttaaattggatcctctcattcttcttcattcatcaaatcgtg |
316 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40642548 |
ttcttgatttttaaggagttgttgagtgtgacaaatcgaggcttgctaaagacaaatgttaaattggatcctctcattcttcttcattcaccaaatcgtg |
40642449 |
T |
|
| Q |
317 |
ttcatctc |
324 |
Q |
| |
|
|| ||||| |
|
|
| T |
40642448 |
tttatctc |
40642441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University