View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5192_high_18 (Length: 261)

Name: NF5192_high_18
Description: NF5192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5192_high_18
NF5192_high_18
[»] chr5 (1 HSPs)
chr5 (147-227)||(41796289-41796369)


Alignment Details
Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 147 - 227
Target Start/End: Original strand, 41796289 - 41796369
Alignment:
147 ctaaaattgtcaaatgatgtttataattgggatggaacttggaagtggtaccatatgtccttgcaaagccaacgggggtat 227  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41796289 ctaaaattgtcaaatgatgtttataattgggatggaacttggaagtggtaccatatgtccttgcaaagccaacgggggtat 41796369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University