View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5192_low_11 (Length: 349)
Name: NF5192_low_11
Description: NF5192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5192_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 197 - 292
Target Start/End: Complemental strand, 31270179 - 31270084
Alignment:
| Q |
197 |
gcccatattaacagtaattcgatatattaggacattttcttctggaacccagtcaaaactcatggtttgttaatttatttatttaactttttgact |
292 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31270179 |
gcccatattaacagtaattcgatttattaggacattttcttctggaacccagtcaaaacttatggtttgttaatttatttatttaactttttgact |
31270084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 23 - 112
Target Start/End: Complemental strand, 31270352 - 31270264
Alignment:
| Q |
23 |
tttggtttttggcaacaaatctgagcgtaatttgttattttctccatcagctattccatattgttgatttctaagaacatatttattaag |
112 |
Q |
| |
|
|||| |||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
31270352 |
tttgattttgggcaacaaatcagagcgtaatttgttattttctccatcagctattccatattg-tgatttctaaaaccatatttattaag |
31270264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University