View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5192_low_13 (Length: 339)
Name: NF5192_low_13
Description: NF5192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5192_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 19 - 90
Target Start/End: Complemental strand, 860830 - 860759
Alignment:
| Q |
19 |
catgaattgaaagtgacacaccatgtggggaatgtaaaatgttgagcattatgttgcatatgttgtgtcaag |
90 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||| |||||| |||||| |||||||||||| |
|
|
| T |
860830 |
catgaattgaaagtgacacaccatgtggtgaatgtagaatgttgaacattatattgcatgtgttgtgtcaag |
860759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University