View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5192_low_20 (Length: 281)
Name: NF5192_low_20
Description: NF5192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5192_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 21 - 274
Target Start/End: Original strand, 2018818 - 2019071
Alignment:
| Q |
21 |
ttactttcaaagatggctcttcctatatcaattttccattactcaaatccctaaatttgaacgacgtcgtctttggaaaccgtgctaacatgttggacnn |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
2018818 |
ttactttcaaagatggctcttcctatatcaattttccattactcaaatcccttaatttgaacgacgtcgtctttggaaatcgtgctaacatgtttgactt |
2018917 |
T |
 |
| Q |
121 |
nnnnngcggatgtcccaatgttgaagatgtagaagtgacttcactatcaatagttaatagtcgcattcctcagccaccagaagagggggttgaagcctta |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2018918 |
tttttgcggatgtcccaatgttgaagatgtagaagtgacatcactatcaatagttaatagtcgcattcctcagccaccagaagagggggttgaagcctta |
2019017 |
T |
 |
| Q |
221 |
ccaaagttggtcagagcaaaaatttcagaattatatagcatgttacctttgctt |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2019018 |
ccaaagttggtcagagcaaaaatttcagaattacatagcatgttacctttgctt |
2019071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University