View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5192_low_26 (Length: 250)
Name: NF5192_low_26
Description: NF5192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5192_low_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 20 - 158
Target Start/End: Complemental strand, 34787453 - 34787315
Alignment:
| Q |
20 |
gggtctgcaactttggaagaagacatggctagggcttggaaaaccctaacgatagagaaagaggaagaatgtgtttttgtttctgttgagtgtgtaaatc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34787453 |
gggtctgcaactttggaagaagacatggctagggcttggaaaaccctaacgatagagaaagaggaagaatgtgtttttgtttctgttgagtgtgtaaatc |
34787354 |
T |
|
| Q |
120 |
tttcttatttaaataggtttcttcacgggcttttcggct |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34787353 |
tttcttatttaaataggtttcttcacgggcttttcggct |
34787315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 20 - 53
Target Start/End: Original strand, 2293744 - 2293777
Alignment:
| Q |
20 |
gggtctgcaactttggaagaagacatggctaggg |
53 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
2293744 |
gggtctgcatctttggaagaagacatggctaggg |
2293777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University