View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5192_low_28 (Length: 232)
Name: NF5192_low_28
Description: NF5192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5192_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 7e-67; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 69 - 208
Target Start/End: Original strand, 7506988 - 7507130
Alignment:
| Q |
69 |
caaatcttatgcatacggtcatcaactttttataacactacaatctctacattttaaaaattgtcttaagcttcaattgcttgtggcgcaagtaactgag |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7506988 |
caaatcttatgcatacggtcatcaactttttataacactacaatctctacattttaaaaattgtcttaagcttcaattgcttgtggcgcaagtaactgag |
7507087 |
T |
|
| Q |
169 |
gtgtacggttc---tcttcttctttaacaataactaacaccta |
208 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7507088 |
gtgtacggttctcttcttcttctttaacaataactaacaccta |
7507130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 72
Target Start/End: Original strand, 7506877 - 7506931
Alignment:
| Q |
19 |
ccacttagtcataggacccaccattgtgtgtataatttgc-attcgaatgtcaaa |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
7506877 |
ccacttagtcataggacccaccattgtgtgtataatttgcaattcaaatgtcaaa |
7506931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 132 - 187
Target Start/End: Original strand, 27908721 - 27908776
Alignment:
| Q |
132 |
tcttaagcttcaattgcttgtggcgcaagtaactgaggtgtacggttctcttcttc |
187 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||| || ||| ||| ||||| |
|
|
| T |
27908721 |
tcttaagcttcgattgcttgtggcgcaagtaactaaggtttatggtgctcatcttc |
27908776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 49
Target Start/End: Complemental strand, 7507838 - 7507808
Alignment:
| Q |
19 |
ccacttagtcataggacccaccattgtgtgt |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7507838 |
ccacttagtcataggacccaccattgtgtgt |
7507808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 125 - 169
Target Start/End: Original strand, 4537958 - 4538002
Alignment:
| Q |
125 |
aaaattgtcttaagcttcaattgcttgtggcgcaagtaactgagg |
169 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4537958 |
aaaattgtcttaagcttcaattgcttgtatcgcaagtaactgagg |
4538002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University