View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5192_low_29 (Length: 226)
Name: NF5192_low_29
Description: NF5192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5192_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 212
Target Start/End: Original strand, 42658639 - 42658834
Alignment:
| Q |
17 |
aacaagaaaggtaacaacttacttcaacaacactcaaatatacaacttcaactataatgtaccaacaaaagaagcttataaactactcaaacatgcaaga |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42658639 |
aacaagaaaggtaacaactaacttcaacaacactcaaatatacaacttcaactataatgtaccaacaaaagaagcttataaactactcaaacatgcaaga |
42658738 |
T |
 |
| Q |
117 |
aacaatccagcatgtacaccaaactcaagacaccttcaaacatcaaaatgtaaacttgcattgaaaaatttgcctgcaatagtatatgagaagaat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42658739 |
aacaatccagcatgtacaccaaactcaagacaccttcaaacatcaaaatgtaaacttgcattgaaaaatttgcctgcaatagtatatgagaagaat |
42658834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University