View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5193-Insertion-3 (Length: 114)
Name: NF5193-Insertion-3
Description: NF5193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5193-Insertion-3 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 4e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 41105307 - 41105413
Alignment:
| Q |
8 |
aatccaactcaagaacaaatctctttgtttcttcaccttgcattgcaataaccgcaaaaaacccttcaggaacagttgtttctgtttcactctcttcatc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41105307 |
aatccaactcaagaacaaatctctttgtttcttcaccttgcattgcaataaccgcaaaaaacccttcaggaacagttgtttctgtttcactctcttcatc |
41105406 |
T |
 |
| Q |
108 |
atcaatg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
41105407 |
atcaatg |
41105413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University