View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5193-Insertion-9 (Length: 235)
Name: NF5193-Insertion-9
Description: NF5193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5193-Insertion-9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 9 - 108
Target Start/End: Original strand, 43076078 - 43076177
Alignment:
| Q |
9 |
atatagtttcgtaaagagcttggaaagtgagtgttatgttatcccaacaagaatatttttcacattcacacacaagaataaagggactcacgggaagcac |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43076078 |
atatagtttcgtaaagagcttggaaagtgagtgttatgttatcccaacaagaatacttttcacattcacacacaagaataaagggactcacgggaagcac |
43076177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 197 - 235
Target Start/End: Original strand, 43076266 - 43076304
Alignment:
| Q |
197 |
tgcaacatgtcccgtgcctgtggtttagaatttagattg |
235 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43076266 |
tgcaacatgtcctgtgcctgtggtttagaatttagattg |
43076304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University