View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5193_high_18 (Length: 282)
Name: NF5193_high_18
Description: NF5193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5193_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 14 - 243
Target Start/End: Complemental strand, 49423675 - 49423446
Alignment:
| Q |
14 |
cagagacacaaacaccaagctcacagaagcctttctaactgccatgactcgatttacagcatggacaaagattaaacgagtagttgatctcccaaactat |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49423675 |
cagacacacaaacaccaagctcacagaagcctttctaactgccatgactcgatttacagcatggacaaagattaaacgagtagttgatctcccaaactat |
49423576 |
T |
 |
| Q |
114 |
tcccatcaattgatttttgcccgctgagtttaaataatggttcatctatcctctgttttacttgttctaccatgcagctgctgggtttggtggattgaac |
213 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
49423575 |
ttccatcaattgatttttgcccgctgagtttaaataatggttcatctatcctctgttttacttgttctaccatgcagctgctaggtttgatggattgaac |
49423476 |
T |
 |
| Q |
214 |
tgctaaccttgtctccttgtatatgttaag |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49423475 |
tgctaaccttgtctccttgtatatgttaag |
49423446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 125
Target Start/End: Complemental strand, 49432085 - 49431982
Alignment:
| Q |
20 |
cacaaacaccaagctcacagaagcctttctaactgccatgactcgatttacagcatggacaaagattaaacgagtagttgatctcccaaactattcccat |
119 |
Q |
| |
|
||||||||| ||||| ||||| ||| ||||||||||||||||| ||||| |||||| ||||| | ||||||||||||||||||||||||| ||| ||| |
|
|
| T |
49432085 |
cacaaacacgaagctg-cagaatcctatctaactgccatgactc-atttaaagcatgtacaaaaaataaacgagtagttgatctcccaaacaattttcat |
49431988 |
T |
 |
| Q |
120 |
caattg |
125 |
Q |
| |
|
|||||| |
|
|
| T |
49431987 |
caattg |
49431982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 215
Target Start/End: Complemental strand, 49425711 - 49425674
Alignment:
| Q |
178 |
ttctaccatgcagctgctgggtttggtggattgaactg |
215 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
49425711 |
ttctaacatgcaactgctgggtttggtggattgaactg |
49425674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University