View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5193_high_20 (Length: 281)
Name: NF5193_high_20
Description: NF5193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5193_high_20 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 11 - 281
Target Start/End: Original strand, 43322593 - 43322863
Alignment:
| Q |
11 |
cacagatggagtgtgtcattggtggagcagcagttcatcacatgataaagaagactgtttggtgtcatttgacttcgtcaacgagttgtttttcacaaca |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43322593 |
cacaaatggagtgtgtcattggtggagcaacagttcatcacatgataaagaagactgtttggtgtcatttgacttcgtcaactagttgtttttcacaaca |
43322692 |
T |
|
| Q |
111 |
cctatgttgttagatgtggatgaaagttgtgattattattccattgagagatgtttggtggtgttaaatgagtcaattgctttaatctcaaattgtccag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43322693 |
cctatgttgttagatgtggatgaaagttgttattattattccattgagagatgtttggtggtgttaaatgagtcaattgctttaatctcaaattgtccaa |
43322792 |
T |
|
| Q |
211 |
atgctactacttttcatatttcgattttgggtgaactcggtgtaaagaaattatggatcaaactctttatt |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43322793 |
atgctactacttttcatatttcgattttgggtgaactcggtgtaaagaaattatggatcaaactctttatt |
43322863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 234 - 278
Target Start/End: Original strand, 40549293 - 40549337
Alignment:
| Q |
234 |
attttgggtgaactcggtgtaaagaaattatggatcaaactcttt |
278 |
Q |
| |
|
|||||||||||| ||||||| ||| ||| |||||||||||||||| |
|
|
| T |
40549293 |
attttgggtgaagtcggtgtgaaggaatcatggatcaaactcttt |
40549337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 158 - 203
Target Start/End: Complemental strand, 44141571 - 44141526
Alignment:
| Q |
158 |
gagatgtttggtggtgttaaatgagtcaattgctttaatctcaaat |
203 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
44141571 |
gagatatttggtggtgttaaatgggtcaattgctttgatctcaaat |
44141526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 216 - 274
Target Start/End: Complemental strand, 51874779 - 51874721
Alignment:
| Q |
216 |
actacttttcatatttcgattttgggtgaactcggtgtaaagaaattatggatcaaact |
274 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
51874779 |
actacttttaatatttcaattttgggtgaactaagtgtgaaggaatcatggatcaaact |
51874721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 277
Target Start/End: Complemental strand, 44550553 - 44550492
Alignment:
| Q |
216 |
actacttttcatatttcgattttgggtgaactcggtgtaaagaaattatggatcaaactctt |
277 |
Q |
| |
|
||||||||||| || || ||||| |||||| ||||||| ||||||||||||| |||||||| |
|
|
| T |
44550553 |
actacttttcaaatatcaattttaggtgaattcggtgtgaagaaattatggactaaactctt |
44550492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University