View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5193_low_16 (Length: 303)
Name: NF5193_low_16
Description: NF5193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5193_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 15 - 221
Target Start/End: Complemental strand, 27582103 - 27581897
Alignment:
| Q |
15 |
tattacacttatatctatctatctcataaatagaactannnnnnnnnnnnnnnngaaatgaaaagaatcttgactccatatggttccctctctttaagat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
27582103 |
tattacacttatatctatctatctcataaatagaactattttttatttttttttgaaatgaaaagaatcttaactccatatggttccctctctt-aagat |
27582005 |
T |
|
| Q |
115 |
aagcaaggattttannnnnnn-ctctttcaaaatgagccaagcccatttaacaacctttatccccctccctatagccaccacgcacccaacaatttttac |
213 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
27582004 |
aagcaaggattttattttttttctctttcaaaatgagccaagcccatttaacaacctttatccccctccctatagctaccacacacccaacaatttttac |
27581905 |
T |
|
| Q |
214 |
atgttttt |
221 |
Q |
| |
|
|||||||| |
|
|
| T |
27581904 |
atgttttt |
27581897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 27581863 - 27581818
Alignment:
| Q |
244 |
agcattgcttatcagtttataaagtcaatctattttaatcaaaact |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27581863 |
agcattgcttatcagtttataaagtcaatctattttaatcaaaact |
27581818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University