View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5193_low_38 (Length: 223)
Name: NF5193_low_38
Description: NF5193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5193_low_38 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 1885301 - 1885079
Alignment:
| Q |
1 |
tcatcacaggttctagctgattcaggcaaagcttcagcaagtacctgaaactttgtcaatgaaaggtttctatctcttgaaacctctgtaagataactgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1885301 |
tcatcacaggttctagctgattcaggcaaagcttcagcaagtacctgaaactttgtcaatgaaaggtttctatctcttgaaacctctgtaagataactgt |
1885202 |
T |
|
| Q |
101 |
caacaagtcttgctactcttgctttagcattaaggttacatcccaatcccatatgtttctcagaaaatgactgtcttttcggactagaattttcagtcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1885201 |
caacaagtcttgctactcttgctttagcattaaggttacatcccaatcccatatgtttctcagaaaatgactgtcttttcggactagaattttcagtcac |
1885102 |
T |
|
| Q |
201 |
ttcttgtacaagaaaatgctcaa |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
1885101 |
ttcttgtacaagaaaatgctcaa |
1885079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 12 - 145
Target Start/End: Original strand, 37213870 - 37214003
Alignment:
| Q |
12 |
tctagctgattcaggcaaagcttcagcaagtacctgaaactttgtcaatgaaaggtttctatctcttgaaacctctgtaagataactgtcaacaagtctt |
111 |
Q |
| |
|
||||||||| ||||| |||||||| ||||| ||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||| ||||| ||| |
|
|
| T |
37213870 |
tctagctgactcaggtaaagcttctgcaagaacctgaaactttgtcgatgaaaggtttctatctctagatacctctgtaagataactgtccacaagcctt |
37213969 |
T |
|
| Q |
112 |
gctactcttgctttagcattaaggttacatccca |
145 |
Q |
| |
|
|| |||||||| || ||||| ||||||| ||||| |
|
|
| T |
37213970 |
gccactcttgccttggcattcaggttacttccca |
37214003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University