View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5193_low_4 (Length: 567)
Name: NF5193_low_4
Description: NF5193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5193_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 254 - 551
Target Start/End: Complemental strand, 44265577 - 44265280
Alignment:
| Q |
254 |
ttcgcagtcccaacaaatttgataataaatactaccttgatcttatgaaccgtcagggtctctttacttcagaccaagatttgtacactgataagaggac |
353 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44265577 |
ttcgtagtcccaacaaatttgataataaatactaccttgatcttatgaaccatcagggtctctttacttcagaccaagatttgtacactgataagaggac |
44265478 |
T |
 |
| Q |
354 |
taagtatattgttactaactttgctgtgaatcaatctttgttctttgagaaatttgttgctgctatgcttaaaatggggcagcttaatgttttaactgga |
453 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44265477 |
taaggatattgttactaactttgctgtgaatcaatctttgttctttgagaaatttgttgctgctatgcttaaaatggggcagcttaatgttttgactgga |
44265378 |
T |
 |
| Q |
454 |
actaaaggagagattcgagttaattgctctgttaggaataagggtagcaaatcatttcttacttctgctgtggaaggatttttagaaatgtgataact |
551 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44265377 |
actaaaggagagattcgagctaattgctctgttaggaataagggtagcaaatcatttcttacttctgctgtggaaggatttttagaaatgtgataact |
44265280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University