View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5194-Insertion-6 (Length: 167)
Name: NF5194-Insertion-6
Description: NF5194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5194-Insertion-6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 3e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 3e-31
Query Start/End: Original strand, 8 - 167
Target Start/End: Complemental strand, 2764804 - 2764648
Alignment:
| Q |
8 |
atacctatagtatattactttggtcttttataagtttggactagccaatttagtaatcataaatatataannnnnnnnnnctaaaaagaaaagcttgata |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |
|
|
| T |
2764804 |
atacctatagtatattactttggtcttttataagtttggactagccaatttagtcatcataaatatata--tttttttttctaaaaagaaaagcctgtta |
2764707 |
T |
 |
| Q |
108 |
aaaatattgtataacaatatttttaattgacatagcnnnnnnncaatttgcaatatcagg |
167 |
Q |
| |
|
||||||| ||| |||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
2764706 |
aaaatatgttat-acaatatttttaatcgacatagctttttttcaatttgcaatatcagg |
2764648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University